Mutacja w genie kodującym stymulujące białko G cyklazy adenylanowej w dziedzicznym osteodystrofii Albrighta czesc 4

Gęstość optyczną każdego pasma zmierzono za pomocą dwuwymiarowej densytometrii skaningowej. Regiony obszaru blot odpowiadającego pasmom zostały wycięte, a ilość radioaktywności oznaczono ilościowo za pomocą spektrometrii gamma. Reakcja łańcuchowa polimerazy
Figura 5. Figura 5. Amplifikacja in vitro genu Gs. z użyciem genomowego DNA i reakcji łańcuchowej polimerazy (PCR). Startery oligonukleotydowe flankują region 260-bp (obszar zakreskowany) egzonu ludzkiego genu Gs., wytwarzając zamplifikowany fragment o tym samym rozmiarze w reakcji łańcuchowej polimerazy. Starter 5 , DV 157, składa się z 21 zasad komplementarnych do opublikowanej prawidłowej sekwencji ludzkiego genu Gs., 31 z dodatkiem siedmiu niehomologicznych zasad na końcu 5 startera, aby stworzyć sztuczne miejsce rozpoznawania EcoRI: 5 CCGAATTCGCTCCTTGCCGAGGAGCCGA (-141 do -113). Antysensowny 3 starter, MAL-2, składa się z 21 zasad komplementarnych do ludzkiego genu Gs.: 5 TGGCCCGGTTACACCTGCTTGT (+98 do +119). Część A pokazuje zamplifikowany region genomowego DNA flankujący miejsce restrykcyjne Ncol egzonu 1. Część B pokazuje produkty amplifikacji analizowane na 3% żelu agarozowym SeaKem z NuSieve-1% zabarwionym bromkiem etydyny. Ścieżka przedstawia DNA od pacjenta; ścieżka 2, DNA od matki; i ścieżkę 3, DNA od normalnego osobnika. Strzałka wskazuje produkt amplifikacyjny o wielkości 260 pz. Część C przedstawia analizę metodą Southerna zamplifikowanych produktów po ich przeniesieniu na membranę nylonową i hybrydyzacji z wewnętrznym starterem znakowanym 32Pend. Fragment o wielkości 260 pz na autoradiogramie jest oznaczony strzałką.
Reakcja łańcuchowa polimerazy została przeprowadzona zgodnie z dwustopniową modyfikacją36 metody opisanej przez Saiki i wsp., 37 z automatycznym termocyklerem DNA (Perkin Elmer-Cetus, Norwalk, Conn.). Pięćset nanogramów genomowego DNA od każdego pacjenta dodano do 100 .l objętości z 0,2 .mol każdego startera stosowanego w reakcji łańcuchowej polimerazy (opisane w legendzie do Fig. 5), 2,5 jednostki polimerazy DNA Taq (Perkin Elmer- Cetus), 100 .mol każdego z dATP, dCTP i dTTP i 200 .mol 5 -trifosforanu 7 -deaza-2 -deoksyguanozyny (dc7GTP) zamiast dGTP. Po początkowej denaturacji przez pięć minut w 94 ° C, warunki denaturacji ustawiono na 30 sekund w 94 ° C, a następnie przez minutę w temperaturze 58 ° C do wyżarzania i przez 2 minuty w temperaturze 72 ° C w celu wydłużenia. Po 30 cyklach amplifikacji DNA (etap 1), dodano 100 umoli dGTP i 100 umoli dc7GTP i przeprowadzono dodatkowe 30 cykli amplifikacji, jak opisano powyżej. Aby ocenić procedurę, 10 do 20 procent mieszaniny reakcyjnej analizowano przez elektroforezę na 3% agarozie NuSieve agaroza-1% agarozie SeaKem GTG (FMC Bioproducts, Rockville, Md.), Zabarwiono bromkiem etydyny i sfotografowano. Fragmenty DNA przeniesiono następnie na membrany nylonowe przez pasywną dyfuzję kapilarną i hybrydyzowano z wyznakowanym radioaktywnie oligonukleotydem 21-zasadowym (MAL-3) składającym się z sekwencji nukleotydowej (5 CTTCTGCAGCTGCTTCTCGAT, +75 do +96) wewnątrz dwóch primerów. stosowany do amplifikacji egzonu genu Gs.. Końcowe płukanie po hybrydyzacji zawierało 3 M chlorek tetrametyloamoniowy.38
Bezpośrednie sekwencjonowanie amplifikowanego DNA
Zamplifikowane fragmenty DNA poddano bezpośredniemu sekwencjonowaniu nukleotydowemu przez modyfikację 39 metody kończenia łańcucha dideoksyowego Sangera i wsp. 40 z użyciem znakowanego radioaktywnie startera oligonukleotydowego (MAL-3).
Wyniki
Rysunek 2
[więcej w: duomox angina, pełzakowica, ropień brodiego ]